Project creo analysisproiecte

Filtrare

Căutările mele recente
Filtrare după:
Buget
la
la
la
Tip
Aptitudini
Limbi
    Starea proiectului
    118,463 project creo analysis proiecte găsite, la prețul de USD

    Am nevoie de o persoana ce poate face acest proiect despre indoor [conectează-te pentru a consulta linkul URL] trebuie sa contina atat o parte teoretica,cat si una practica.

    $23 / hr (Avg Bid)
    $23 / hr Oferta medie
    3 oferte

    I need a programming php for help me to finish a project creted with cakephp. I search a freelancer from Romania or Spain. Am nevoie de un progrator php cu cunostinte solide de CakePHP si jquery pentru a finaliza un proiect deja inceput. Cred ca proiectul se poate finaliza in mai putin de o luna. Necesito un programador php con conocimientos de Cakephp y jquery (ajax) para finalizar un proyecto....

    $611 (Avg Bid)
    $611 Oferta medie
    12 oferte

    We are a newly launched startup, based out of Bangalore in India. We are creating a premium silver jewelry D2C brand and our website has just been launched. Seeking a digital marketeer with experience in jewelry e-commerce or at the least in the lifestyle space to help us with our digital marketing. We are looking for support in paid marketing through social media marketing and Google SEM. This ...

    $284 (Avg Bid)
    $284 Oferta medie
    4 oferte

    It’s a civil engineering work, and require a SAP expert ,with extensive training in structures and concrete and long experience in structural analysis. Require some structural , model, drawings and comprobations.

    $72 (Avg Bid)
    $72 Oferta medie
    4 oferte

    Hola, Necesito un experto en Typescript para hacer una consulta en concreto con un método que encapsula las llamadas al SDK de AWS que tengo hecho. Necesito definir algunos types. Presupuesto: $10 Creo que tomaria 10 minutos.

    $5 / hr (Avg Bid)
    $5 / hr Oferta medie
    1 oferte

    In a paragraph: -------------- There are a lot of software robots trying to access the servers in the Internet without permission. It is neccesary to make an application running continuously in the server to be a guard of what is happening related to attacks, work-load and unauthorized access to the server. Server characteristics: --------- Hardware: CPU: Intel(R) Xeon(R) CPU E3-1270 v6 @ 3.80GHz...

    $148 (Avg Bid)
    $148 Oferta medie
    2 oferte

    Statistical analysis is needed to be done for a secondary database, which needs descriptive statistical analysis to see the relationship between dependent and independent variables, also Chi-square tests and Logistic regression analysis. For a cross-sectional study in malnutrition.

    $113 (Avg Bid)
    $113 Oferta medie
    19 oferte
    Finance project 6 zile left
    VERIFICAT

    I want someone expert in finance to do a financial analysis of 4 companies , the data will be provided to you , all you have to do is analyze the data and present the findings , this is small task of max budget $10

    $16 (Avg Bid)
    $16 Oferta medie
    9 oferte
    Article analysis 6 zile left
    VERIFICAT

    Article analysis following certain criteria.

    $22 (Avg Bid)
    $22 Oferta medie
    27 oferte

    What is required? - Writing bibliometric article (similar to the model paper) with the same structure - Key words: o Digitization; Internationalization; Science Mapping; Bibliometric Analysis; Content Analysis; International Business - Introduction Research Question: What are the research perspectives dealing with digitization and internationalization? In order to answer the research question: ...

    $101 (Avg Bid)
    $101 Oferta medie
    20 oferte

    The Master’s thesis is “Social Media and Society” and its title is: The impact of digital opinion leadership on political interest and participation in post-dictatorship Tunisia. I will provide the part of the thesis which is made up of the introduction and the literature review for better understanding of the research questions and the scope of the explored possible results. I w...

    $212 (Avg Bid)
    $212 Oferta medie
    13 oferte
    sistema ERP 6 zile left

    Hi, At this moment we have a system developed in Java with spring, hibernate and jpa with a database in MySQL, which allows us to add, modify products with simple data such as code, barcode, purchase price,% of profit, per family o type of product and supplier and a simple inventory. Customers and suppliers with simple data such as address and personal data, accounts receivable with receipts, use...

    $4750 (Avg Bid)
    $4750 Oferta medie
    4 oferte

    I need a BA to research all the AI Categories and Sub Categories for a Artificial Intelligence website. Also help with website copy.

    $99 (Avg Bid)
    $99 Oferta medie
    20 oferte

    Use the data to conduct profitability comparative analysis Use software modeling to do linear regression analysis. Need methodology and result discussion

    $126 (Avg Bid)
    $126 Oferta medie
    13 oferte

    Looking for an Analyst to analyse a dataset and answer two questions, one in SQL and the other in Python and provide results in a precise and clear presentation. This is a one time project and would need a smart analyst to handle the project.

    $27 (Avg Bid)
    $27 Oferta medie
    5 oferte

    Logistic regression report, including: - Introduction - Exploratory analysis - From initial to final model - Results - Comments about the data/analysis - Interpretation and conclusions for a lay audience

    $192 (Avg Bid)
    $192 Oferta medie
    26 oferte

    GET ME A TOOL FOR FORENSIC ANALYSIS WHICH WILL GET ME THE BROWSER DATA FROM RAM

    $502 - $1004
    $502 - $1004
    0 oferte

    GET ME A TOOL FOR FORENSIC ANALYSIS WHICH WILL GET ME THE BROWSER DATA FROM RAM

    $20 - $167
    $20 - $167
    0 oferte

    GET ME A TOOL FOR FORENSIC ANALYSIS WHICH WILL GET ME THE BROWSER DATA FROM RAM

    $20 - $167
    $20 - $167
    0 oferte

    I have a data analysis task.i am very honest

    $3 / hr (Avg Bid)
    $3 / hr Oferta medie
    7 oferte
    Static Analysis 6 zile left

    Hi everyone, I need your help to create static analysis in Ansys Workbench. The motorcycle design was already meshed. The tasks will be, For the first time you can try to take displacements on the front wheel for x, y, z. and on the rear wheel y, and z. also set to zero displacements all revolute and translation joints . you will add gravity. And run the simulation

    $20 (Avg Bid)
    $20 Oferta medie
    7 oferte

    I need basic analysis on DNA Eg: ATGCCCCAACTAAATACCGCCGTATGACCCACCATAATTACCCCCATACTCCTGACACTATTTCTCGTCACCCAACTAAAAATATTAAATTCAAATTACCATCTACCCCCCTCACCAAAACCCATAAAAATAAAAAACTACAATAAACCCTGAGAACCAAAATGAACGAAAATCTATTCGCTTCATTCGCTGCCCCCACAATCCTAG

    $6 / hr (Avg Bid)
    $6 / hr Oferta medie
    3 oferte
    data processing 6 zile left

    I have a data analysis task. I needed someone who can help me with this

    $2365 (Avg Bid)
    $2365 Oferta medie
    11 oferte

    The design of street lights using solar energy.

    $170 (Avg Bid)
    $170 Oferta medie
    11 oferte

    This position is responsible for coding, configuration, testing, system performance optimization, and interoperability issues. The Software Developer will work with business product owners, developers, and quality analysts to drive value delivery and will participate in all phases of Agile software development. As a Senior .NET Development Consultant, you will work closely with our clients and tec...

    $16 / hr (Avg Bid)
    $16 / hr Oferta medie
    10 oferte

    I show you a classification problem where you have a dataframe with 24 features and a target column with 5 categories (0,1,2,3,4) The challenge is: To Do all data analysis at your free election to understand what features could be the best to include in our model to get the higher evaluation metric Select those features that best will perform in our model At your free election do any feature eng...

    $121 (Avg Bid)
    $121 Oferta medie
    6 oferte

    Use the data to conduct profitability comparative analysis Use software modeling to do linear regression analysis. Need methodology and result discussion

    $81 (Avg Bid)
    $81 Oferta medie
    6 oferte

    The research gap analysis requires you to study at least fifteen (15) related and recent papers presented at relevant conferences and journals. These should be related to IoT underpinning technologies, tools and models. The objective is to help you to review and evaluate state-of-the-art in IoT [conectează-te pentru a consulta linkul URL] avenues such as relevant IEEE conferences or Journals as we...

    $159 (Avg Bid)
    $159 Oferta medie
    14 oferte

    1. Logistic regression report, including: - Introduction - Exploratory analysis - From initial to final model - Results - Comments about the data/analysis - Interpretation and conclusions for a lay audience

    $266 (Avg Bid)
    $266 Oferta medie
    20 oferte

    I have a data analysis actually need a person that will be taking care of my business on my behalf

    $30 / hr (Avg Bid)
    $30 / hr Oferta medie
    14 oferte

    A SAP expert require ,with extensive training in structures and concrete and long experience in structural analysis. Require some structural summary, report, model, drawings and comprobations.

    $149 (Avg Bid)
    $149 Oferta medie
    5 oferte

    Greetings My requirement I need some one who will guide me and support me in my current and future online projects Freelancer must possess great skills with good communication + analytical ability , you must provide good ideas to our projects using your skills and experience Nature of the work is : online research 1) the freelancer must have excellent internet research skill a)research on go...

    $59 (Avg Bid)
    $59 Oferta medie
    22 oferte

    financial and accounting, financial modeling, CFA, CPA, CIMA, stock market analysis, fundamental and technical analysis.

    $16 (Avg Bid)
    $16 Oferta medie
    4 oferte

    The project is about constructing a glove factory from start to end. Below are the required things to be mentioned: • Introduction: Description of the company, nature of business, list of past awarded projects, etc. • Project details: Description, purpose, duration, location, etc. • Project selection model: Financial model or scoring model in calculation. • Project scope manag...

    $157 (Avg Bid)
    $157 Oferta medie
    4 oferte

    write a report for these topics : 1- Risk and Sensitivity Analysis 2- Economic Analysis in Public Service Sector the refference will be attached

    $26 (Avg Bid)
    $26 Oferta medie
    25 oferte

    The aim of research: To investigate and evaluate the frequency and reasons of new diagnosed trauma cases and its association with seasons among my fellow university students Objectives: 1. To investigate frequency of newly diagnosed trauma cases by gender and faculties 2. To evaluate and compare the frequency of newly diagnosed trauma cases by seasons (in the winter and summer) 3. ...

    $96 (Avg Bid)
    $96 Oferta medie
    8 oferte
    shopify store 6 zile left

    Hello, please no copy paste bid if you can provide the right winning products according to the guide line I mentioned then why not, we can move forward: - 5 Winning Product - Product should not be available nearby and should not be FMCG - Product should not have variations and should have consistent sales graph - Suppliers who can deliver the product in less than 10 days - Video Ads for all pro...

    $511 (Avg Bid)
    $511 Oferta medie
    8 oferte

    It's small project focused on how to analysis data by using Python.

    $20 (Avg Bid)
    $20 Oferta medie
    23 oferte

    Greetings My requirement I need some one who will guide me and support me in my current and future online projects Freelancer must possess great skills with good communication + analytical ability , you must provide good ideas to our projects using your skills and experience Nature of the work is : online research 1) the freelancer must have excellent internet research skill a)research on go...

    $58 (Avg Bid)
    $58 Oferta medie
    15 oferte

    I have a data set that contains hundreds of images. Objectives of this project: (1) Based on the pixel values of the images, I want to cluster these images into several groups using different methods, including 5 traditional clustering methods and 4 deep learning clustering methods: a. Traditional clustering methods: K-means (partitioning based), BIRCH (hierarchical), DBS...

    $166 (Avg Bid)
    $166 Oferta medie
    8 oferte

    Need a website where users can get advice from experts in finance and investments. Also need some analysis about the number of visitors, their past experience with investment.

    $340 (Avg Bid)
    $340 Oferta medie
    9 oferte

    Use the data to conduct profitability comparative analysis Use software modeling to do linear regression analysis. Need methodology and result discussion

    $16 (Avg Bid)
    $16 Oferta medie
    2 oferte
    $16 Oferta medie
    1 oferte

    design by using solid works and stress analysis

    $8 (Avg Bid)
    $8 Oferta medie
    2 oferte

    My project is to study the bending behaviour of biodegradable STENTS. Stents have cylindrical shape in which lateral surface consists of bridging units of W or N or M shape and the 2 base surface connects those bridging units.I have done all the research part.I need someone to do Stress Analysis on ansys for me.

    $13 (Avg Bid)
    $13 Oferta medie
    9 oferte

    I require a SAP expert ,with extensive training in structures and concrete and long experience in structural analysis. Require some structural summary, report, model, drawings and comprobations. Skills Required

    $121 (Avg Bid)
    $121 Oferta medie
    12 oferte
    Hybris developer 6 zile left
    VERIFICAT

    It is a system reliability engineering (SRE) project covering application support, toil removal and other SRE principles for B2C and B2B Hybris based implementations 1. Custom code changes for Hybris B2C and B2B platforms mainly in Java and JSP 2. Junits 3. Low level design documents 4. Unit test case documentation 5. Daily status 1. Will be working on assigned incidents/service-request/stories, d...

    $4929 (Avg Bid)
    $4929 Oferta medie
    4 oferte

    - Require to build a voltage current and temperature monitor - MCU based circuit with ability to ready current/voltage/temperature Voltage Measurement 3 voltage channels using the MCU adc - Accuracy = 0.1V - Range = 0-85V Current Measurement 1 shunt based current monitor through which the circuit current will pass - Accuracy = 0.1A - Current Range : 0-30A Temperature Measurement - 3 temperatu...

    $424 (Avg Bid)
    $424 Oferta medie
    13 oferte

    am looking to hire a full-stack developer expert in Angular, Angular JS, Java Springboot with hibernate, MyBatis, Tomcat. Microsoft SQL server this is a full-time opportunity and you will be working Mon-Friday 8 am PST - 5 pm PST. candidate should have the following: Experience with Spring Boot and Java Persistence API MyBatis Experience with Microsoft SQL Server and Oracle; stored procedure, fu...

    $22 / hr (Avg Bid)
    $22 / hr Oferta medie
    12 oferte

    Being a professional quantitative data analysis provider, I offer the following services: #Descriptive analysis of survey data with SPSS # Inferrential analysis of survey data with SPSS # Produce model with Smartpls # Present the value of the mean, median, Cronbach's, T-test, Pearson Test, Reliability Test, etc. I will ensure the credibility and trustworthiness of preserving works.

    $143 (Avg Bid)
    $143 Oferta medie
    13 oferte